Lipid products — Page 19

Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

ARO-AAT is a second-generation RNAi drug. ARO-AAT consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade AAT mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes.

Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS).

Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).

Miravirsen (SPC-3649), a β-d-oxy-locked nucleic acid-modified phosphorothioate antisense oligonucleotide, inhibit the biogenesis of miR-122. Miravirsen (SPC-3649) is used in the study for HCV infections.

Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.

DSG-PEG2K-triGalNAc is a functionalized PEG lipid that enhances targeted drug delivery by binding to the Asialoglycoprotein Receptor (ASGPR) which are predominantly found on the surface of liver cells. By functionalizing DSG-PEG2K with triGalNac, it allows this PEG lipid to be used in the formation of liposomes or LNPs that target the liver for drug delivery.

N7-Methyl-guanosine-5'-triphosphate-5'-adenosine (m7GpppA) is a dinucleotide cap analog that can be used for in vitro RNA transcription.

m7GpppAmpG Na salt is a trinucleotide 5′ cap analog with the capping efficiencies for the obtained RNAs of 90%.

m7GpppAmpG ammonium is a trinucleotide 5′ cap analog with the capping efficiencies for the obtained RNAs of 90%.

3'OMe-m7GpppAmpG ammonium solution (100mM) is a trinucleotide Cap analogue. 3'OMe-m7GpppAmpG ammonium shows a significant translational efficiency. 3'OMe-m7GpppAmpG ammonium can be used as a potential molecular biology tool in the field of mRNA vaccines and mRNA transfection, such as protein production, gene therapy and anti-cancer immunization.

SM-6.1 is a small molecule delivery vehicle developed by Arrowhead, targeting αvβ6, which selectively delivers therapeutic siRNA to lung epithelial cells and mediates durable gene silencing post-inhalation.

SM-6.1 is a small molecule delivery vehicle developed by Arrowhead, targeting αvβ6, which selectively delivers therapeutic siRNA to lung epithelial cells and mediates durable gene silencing post-inhalation.

6-[1-(Hexyloxy)ethoxy]hexanal is the tail fragement for MK16.MK16 is a novel blood-brain barrier (BBB)-crossing lipid nanoparticle (BLNP) platform developed for efficient mRNA delivery to the central nervous system (CNS).

Tail of CICL-1 lipid