For research use only. We do not sell to patients.
siRNA, ASO & aptamer drugs / Bepirovirsen
Bepirovirsen chemical structure
CAT. NO. DC71481Featured

Bepirovirsen

Pack size & price

USD
TotalUS$1,200
Ships from ShanghaiFor research use only
Product overview

Description & Application

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

CAS No.1403787-62-1
Chemical NameBepirovirsen
SynonymsBepirovirsen
SMILESNot available
FormulaNot available
M.WtNot available
Purity>95%
Storage2 years -20°C Powder, 2 weeks 4°C in DMSO, 6 months -80°C in DMSO
Shipping conditionShips from Shanghai; packaging confirmed at order.
PublicationNot available
Product classificationsiRNA/ASOs/Aptamer drugs
Laboratory planning

Solution Calculators

The product molecular weight is prefilled when available and remains editable. Confirm solvent compatibility and solubility before preparation.

Mass = concentration × volume × molecular weight
Enter any three values to calculate the fourth.
C₁V₁ = C₂V₂
Enter any three values to calculate the fourth.

Need a different pack size or technical document?

Contact our team with the catalog number and requested quantity.

Contact us
Handling guidance

Shipping, storage and sampling

How is the lipid shipped, and how should I store it?
Ships from Shanghai. Storage: 2 years -20°C Powder, 2 weeks 4°C in DMSO, 6 months -80°C in DMSO
Pure lipid or solution — which should I choose?
Pure lipid is generally more stable during shipping and storage, so we usually recommend the pure form. A solution in ethanol or chloroform can be supplied when required by your workflow. Tell us the intended application, solvent and target concentration so the most suitable format can be confirmed.