Research lipid catalog
Ionizable Lipid Products
Explore 848 lipid and RNA delivery products. Search the full catalog or browse by research category.
Search covers product name, catalog number, synonyms, available CAS numbers and categories. Spaces, hyphens and common punctuation are ignored. Duplicate legacy records are consolidated under one canonical product result.
3666 products · Showing 3161–3180 · 20 per page
DC Chemicals lipid expertise
Built for ionizable-lipid discovery and RNA delivery research
DC Chemicals supports formulation and delivery research with a broad, searchable portfolio of cationic and ionizable lipids. The current directory brings together 848 unique research-use products, with product specifications, pricing, chemical structures and literature-linked formulation data added as each record is verified.
Our experience spans complex lipid synthesis, purification, analytical release and process development. For custom molecules or larger-scale requirements, our team can discuss route development, technical specifications and scale-up options for the intended research workflow.
Learn about cationic and ionizable lipids →Proprietary innovation · Co-development · GMP
From proprietary lipid design to GMP-grade custom synthesis
DC Chemicals has independently developed ionizable-lipid structures supported by company-owned intellectual property, and selected proprietary lipid programs have advanced to GMP-stage development.
We welcome joint development with customers—from molecular design and lipid synthesis through route and process development. We can also support custom synthesis of GMP-grade ionizable lipids to agreed technical specifications and quality requirements.
Discuss a co-development project →Proprietary ionizable-lipid structuresCollaborative molecular designCustom lipid synthesisProcess development and scale-upGMP-grade project support
Product quick links
Explore ionizable lipids
Browse specifications, pricing and literature-linked product information.
Cat. No.Product NameField of ApplicationChemical Structure
GalNac-L96FeaturedFeatured
GalNac-L96, the G-rich oligonucleotides carrying the longer GalNAc linker that can be used for delivery of nucleic acid drugs[1].
tri-GalNAc-COOH (acetylation)FeaturedFeatured
tri-GalNAc-COOH acetylation is the acetylated and modified form of tri-GalNAc-COOH. tri-GalNAc-COOH acetylation can be used for the synthesis of LYTAC.
GalNAc-THA-C6FeaturedFeatured
GalNAc-NAG37FeaturedFeatured
GalNAc-L-9FeaturedFeatured
ASGPR ligand-1FeaturedFeatured
ASGPR ligand-1 is a compound that targets the asialoglycoprotein receptor (ASGPR) and is utilized in various disease research contexts .
THA8 acidFeaturedFeatured
GalNAc-L10FeaturedFeatured
Tri-GalNAc AcidFeaturedFeatured
Triantennary GalNAc Acid is an asialoglycoprotein receptor (ASGPR) ligand for lysosomal targeting chimera (LYTAC) research and development.
Tri-GalNAc-NHS esterFeaturedFeatured
Tri-GalNAc-NHS ester is a LYsosome TArgeting Chimera (LYTAC) and a ligand of asialoglycoprotein receptor (ASGPR). ASGPR is a lysosomal targeting receptor specifically expressed on liver cells, for the degradation of extracellular proteins including membrane proteins. Tri-GalNAc-NHS ester can be used as a protein degrader and it can be used for the research of LYTAC.
Tri-GalNAc(OAc)3FeaturedFeatured
Tri-GalNAc(OAc)3 is a triantenerrary N-acetylgalactosamine (tri-GalNAc) with an amino group, which is useful precursor for synthesis of GalNAc-LYTAC that engage the asialoglycoprotein receptor for targeted protein degradation. Tri-GalNAc(OAc)3 was first reported in Nat Chem Biol. 2021 Sep;17(9):937-946 (compound ). This product has no formal name at the moment.
InclisiranFeaturedFeatured
Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
RovanersenFeaturedFeatured
Rovanersen (WVE-120101) is an antisense oligonucleotide that can be used for huntington’s disease research.
PegaptanibFeaturedFeatured
RemlarsenFeaturedFeatured
Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis.
MipomersenFeaturedFeatured
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Mipomersen sodium) that retains the same biological activity.
LumasiranFeaturedFeatured
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1).
InotersenFeaturedFeatured
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR). The free form of the compound is prone to instability, it is advisable to consider the stable salt form (Inotersen sodium) that retains the same biological activity.
FomivirsenFeaturedFeatured
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
BepirovirsenFeaturedFeatured
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
No products match this search.
Page 159 of 184 · Browse all 3666 products